Flt3 ligand (FLT3LG) (NM_001204503) Human Untagged Clone

CAT#: SC331595

FLT3LG (untagged) - Homo sapiens fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 2



  "NM_001204503" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-FLT3LG (Flt3 ligand) mouse monoclonal antibody, clone OTI8D10 (formerly 8D10), Biotinylated
    • 100 ul

CNY 3,990.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FL; FLG3L; FLT3L
Vector pCMV6-Entry
Sequence Data
>SC331595 representing NM_001204503.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGTGCTGGCGCCAGCCTGGAGCCCAACAACCTATCTCCTCCTGCTGCTGCTGCTGAGCTCGGGA
CTCAGTGGGACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGT
GAGCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTC
TGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCC
AAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCC
CCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCTG
GTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGAC
TCCTCAACCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGGCCACAGCCCCGACAGCCCCGCAGCCC
CCTCTGCTCCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCTGCTGGCCGCTGCCTGGTGCCTGCACTGG
CAGAGGACGCGGCGGAGGACACCCCGCCCTGGGGAGCAGGTGCCCCCCGTCCCCAGTCCCCAGGACCTG
CTGCTTGTGGAGCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204503
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204503.1
RefSeq Size 1094 bp
RefSeq ORF 708 bp
Locus ID 2323
UniProt ID P49771
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Pathways in cancer
MW 26.4 kDa
Gene Summary Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...