VEGFA (NM_001204385) Human Untagged Clone
CAT#: SC331569
VEGFA (untagged) - Homo sapiens vascular endothelial growth factor A (VEGFA), transcript variant 9
CNY 3,420.00
货期*
5周
规格
Product images
经常一起买 (4)
VEGFA (VEGF) mouse monoclonal antibody, clone OTI4E3 (formerly 4E3)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MVCD1; VEGF; VPF |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204385, the custom clone sequence may differ by one or more nucleotides
CTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCTACCACCTCCTCCCCGGCCGGCGGCGGACAG TGGACGCGGCGGCGAGCCGCGGGCAGGGGCCGGAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGGGC TCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCTGTTCTCGCTTCGGAGGAGCCGTGGTCCGC GCGGGGGAAGCCGAGCCGAGCGGAGCCGCGAGAAGTGCTAGCTCGGGCCGGGAGGAGCCGCAGCCGGAGG AGGGGGAGGAGGAAGAAGAGAAGGAAGAGGAGAGGGGGCCGCAGTGGCGACTCGGCGCTCGGAAGCCGGG CTCATGGACGGGTGAGGCGGCGGTGTGCGCAGACAGTGCTCCAGCCGCGCGCGCTCCCCAGGCCCTGGCC CGGGCCTCGGGCCGGGGAGGAAGAGTAGCTCGCCGAGGCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGA GCCGGAGAGGGAGCGCGAGCCGCGCCGGCCCCGGTCGGGCCTCCGAAACCATGAACTTTCTGCTGTCTTG GGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCA GAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATC CAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTG TGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCC AACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTAC AGCACAACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAAAAAATCAGTTCGAGGAAA GGGAAAGGGGCAAAAACGAAAGCGCAAGAAATCCCGGTATAAGTCCTGGAGCGTATGTGACAAGCCGAGG CGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204385 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204385.1, NP_001191314.1 |
RefSeq Size | 3494 bp |
RefSeq ORF | 1056 bp |
Locus ID | 7422 |
UniProt ID | P15692 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Bladder cancer, Cytokine-cytokine receptor interaction, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma, VEGF signaling pathway |
Gene Summary | This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. The levels of VEGF are increased during infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), thus promoting inflammation by facilitating recruitment of inflammatory cells, and by increasing the level of angiopoietin II (Ang II), one of two products of the SARS-CoV-2 binding target, angiotensin-converting enzyme 2 (ACE2). In turn, Ang II facilitates the elevation of VEGF, thus forming a vicious cycle in the release of inflammatory cytokines. [provided by RefSeq, Jun 2020] Transcript Variant: This variant (9) uses an alternate in-frame splice site in the 3' coding region and lacks an alternate in-frame exon compared to variant 1. This variant can initiate translation from four non-AUG (CUG) sites, and also from a downstream, in-frame AUG. The isoform represented in this RefSeq (isoform r) is derived from the 5'-most CUG start codon, and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...