NEK2 (NM_001204182) Human Untagged Clone

CAT#: SC331515

NEK2 (untagged) - Homo sapiens NIMA-related kinase 2 (NEK2), transcript variant 3



  "NM_001204182" in other vectors (2)

CNY 3,710.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NEK2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsPK21; NEK2A; NLK1; PPP1R111; RP67
Vector pCMV6-Entry
Sequence Data
>SC331515 representing NM_001204182.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTTCCCGGGCTGAGGACTATGAAGTGTTGTACACCATTGGCACAGGCTCCTACGGCCGCTGCCAG
AAGATCCGGAGGAAGAGTGATGGCAAGATATTAGTTTGGAAAGAACTTGACTATGGCTCCATGACAGAA
GCTGAGAAACAGATGCTTGTTTCTGAAGTGAATTTGCTTCGTGAACTGAAACATCCAAACATCGTTCGT
TACTATGATCGGATTATTGACCGGACCAATACAACACTGTACATTGTAATGGAATATTGTGAAGGAGGG
GATCTGGCTAGTGTAATTACAAAGGGAACCAAGGAAAGGCAATACTTAGATGAAGAGTTTGTTCTTCGA
GTGATGACTCAGTTGACTCTGGCCCTGAAGGAATGCCACAGACGAAGTGATGGTGGTCATACCGTATTG
CATCGGGATCTGAAACCAGCCAATGTTTTCCTGGATGGCAAGCAAAACGTCAAGCTTGGAGACTTTGGG
CTAGCTAGAATATTAAACCATGACACGAGTTTTGCAAAAACATTTGTTGGCACACCTTATTACATGTCT
CCTGAACAAATGAATCGCATGTCCTACAATGAGAAATCAGATATCTGGTCATTGGGCTGCTTGCTGTAT
GAGTTATGTGCATTAATGCCTCCATTTACAGCTTTTAGCCAGAAAGAACTCGCTGGGAAAATCAGAGAA
GGCAAATTCAGGCGAATTCCATACCGTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAAC
TTAAAGGATTACCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTTGCA
GACGAGCAAAGAAGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAGAAAAATCGCAGGATTCC
AGCCCTGTATTGAGTGAGCTGAAACTGAAGGAAATTCAGTTACAGGAGCGAGAGCGAGCTCTCAAAGCA
AGAGAAGAAAGATTGGAGCAGAAAGAACAGGAGCTTTGTGTTCGTGAGAGACTAGCAGAGGACAAACTG
GCTAGAGCAGAAAATCTGTTGAAGAACTACAGCTTGCTAAAGGAACGGAAGTTCCTGTCTCTGGCAAGT
AATCCAGAGTCTCACTTTGTTGCCCAGGCTGGAATGCAGTGGTGTGATCACAGCTCAATGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001204182
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204182.1
RefSeq Size 1750 bp
RefSeq ORF 1167 bp
Locus ID 4751
UniProt ID P51955
Protein Families Druggable Genome, Protein Kinase
MW 45.2 kDa
Gene Summary This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...