MCK10 (DDR1) (NM_001202521) Human Untagged Clone

CAT#: SC331465

DDR1 (untagged) - Homo sapiens discoidin domain receptor tyrosine kinase 1 (DDR1), transcript variant 4



  "NM_001202521" in other vectors (2)

CNY 4,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal DDR1 (Tyr513) antibody(Phospho-specific)
    • 100 ul

CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAK; CD167; DDR; EDDR1; HGK2; MCK10; NEP; NTRK4; PTK3; PTK3A; RTK6; TRKE
Vector pCMV6-Entry
Sequence Data
>SC331465 representing NM_001202521.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGACCAGAGGCCCTGTCATCTTTACTGCTGCTGCTCTTGGTGGCAAGTGGAGATGCTGACATGAAG
GGACATTTTGATCCTGCCAAGTGCCGCTATGCCCTGGGCATGCAGGACCGGACCATCCCAGACAGTGAC
ATCTCTGCTTCCAGCTCCTGGTCAGATTCCACTGCCGCCCGCCACAGCAGGTTGGAGAGCAGTGACGGG
GATGGGGCCTGGTGCCCCGCAGGGTCGGTGTTTCCCAAGGAGGAGGAGTACTTGCAGGTGGATCTACAA
CGACTGCACCTGGTGGCTCTGGTGGGCACCCAGGGACGGCATGCCGGGGGCCTGGGCAAGGAGTTCTCC
CGGAGCTACCGGCTGCGTTACTCCCGGGATGGTCGCCGCTGGATGGGCTGGAAGGACCGCTGGGGTCAG
GAGGTGATCTCAGGCAATGAGGACCCTGAGGGAGTGGTGCTGAAGGACCTTGGGCCCCCCATGGTTGCC
CGACTGGTTCGCTTCTACCCCCGGGCTGACCGGGTCATGAGCGTCTGTCTGCGGGTAGAGCTCTATGGC
TGCCTCTGGAGGGATGGACTCCTGTCTTACACCGCCCCTGTGGGGCAGACAATGTATTTATCTGAGGCC
GTGTACCTCAACGACTCCACCTATGACGGACATACCGTGGGCGGACTGCAGTATGGGGGTCTGGGCCAG
CTGGCAGATGGTGTGGTGGGGCTGGATGACTTTAGGAAGAGTCAGGAGCTGCGGGTCTGGCCAGGCTAT
GACTATGTGGGATGGAGCAACCACAGCTTCTCCAGTGGCTATGTGGAGATGGAGTTTGAGTTTGACCGG
CTGAGGGCCTTCCAGGCTATGCAGGTCCACTGTAACAACATGCACACGCTGGGAGCCCGTCTGCCTGGC
GGGGTGGAATGTCGCTTCCGGCGTGGCCCTGCCATGGCCTGGGAGGGGGAGCCCATGCGCCACAACCTA
GGGGGCAACCTGGGGGACCCCAGAGCCCGGGCTGTCTCAGTGCCCCTTGGCGGCCGTGTGGCTCGCTTT
CTGCAGTGCCGCTTCCTCTTTGCGGGGCCCTGGTTACTCTTCAGCGAAATCTCCTTCATCTCTGATGTG
GTGAACAATTCCTCTCCGGCACTGGGAGGCACCTTCCCGCCAGCCCCCTGGTGGCCGCCTGGCCCACCT
CCCACCAACTTCAGCAGCTTGGAGCTGGAGCCCAGAGGCCAGCAGCCCGTGGCCAAGGCCGAGGGGAGC
CCGACCGCCATCCTCATCGGCTGCCTGGTGGCCATCATCCTGCTCCTGCTGCTCATCATTGCCCTCATG
CTCTGGCGGCTGCACTGGCGCAGGCTCCTCAGCAAGGCTGAACGGAGGGTGTTGGAAGAGGAGCTGACG
GTTCACCTCTCTGTCCCTGGGGACACTATCCTCATCAACAACCGCCCAGGTCCTAGAGAGCCACCCCCG
TACCAGGAGCCCCGGCCTCGTGGGAATCCGCCCCACTCCGCTCCCTGTGTCCCCAATGGCTCTGGTGCA
CCTGTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001202521
Insert Size 1527 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202521.1
RefSeq Size 3304 bp
RefSeq ORF 1527 bp
Locus ID 780
UniProt ID Q08345
Protein Families Druggable Genome, Protein Kinase, Transmembrane
MW 56.1 kDa
Gene Summary Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (4) is missing an internal coding exon compared to variant 1. This results in a frame-shift, and early translation termination, rendering this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, the encoded isoform (4, also known as DDR1d) is represented as it has been detected in vivo in several colon carcinoma cell lines (PMID:11344127). This isoform is truncated and lacks the catalytic tyrosine kinase domain, therefore, most likely lacks intrinsic tyrosine kinase activity. It may function in some other regulatory capacity.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...