Cathepsin S (CTSS) (NM_001199739) Human Untagged Clone

CAT#: SC331351

CTSS (untagged) - Homo sapiens cathepsin S (CTSS), transcript variant 2



  "NM_001199739" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CTSS rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331351 representing NM_001199739.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAACGGCTGGTTTGTGTGCTCTTGGTGTGCTCCTCTGCAGTGGCACAGTTGCATAAAGATCCTACC
CTGGATCACCACTGGCATCTCTGGAAGAAAACCTATGGCAAACAATACAAGGAAAAGAATGAAGAAGCA
GTACGACGTCTCATCTGGGAAAAGAATCTAAAGTTTGTGATGCTTCACAACCTGGAGCATTCAATGGGA
ATGCACTCATACGATCTGGGCATGAACCACCTGGGAGACATGGGTTCTTGTGGTGCTTGCTGGGCTTTC
AGTGCTGTGGGGGCCCTGGAAGCACAGCTGAAGCTGAAAACAGGAAAGCTGGTGTCTCTCAGTGCCCAG
AACCTGGTGGATTGCTCAACTGAAAAATATGGAAACAAAGGCTGCAATGGTGGCTTCATGACAACGGCT
TTCCAGTACATCATTGATAACAAGGGCATCGACTCAGACGCTTCCTATCCCTACAAAGCCATGGATCAG
AAATGTCAATATGACTCAAAATATCGTGCTGCCACATGTTCAAAGTACACTGAACTTCCTTATGGCAGA
GAAGATGTCCTGAAAGAAGCTGTGGCCAATAAAGGCCCAGTGTCTGTTGGTGTAGATGCGCGTCATCCT
TCTTTCTTCCTCTACAGAAGTGGTGTCTACTATGAACCATCCTGTACTCAGAATGTGAATCATGGTGTA
CTTGTGGTTGGCTATGGTGATCTTAATGGGAAAGAATACTGGCTTGTGAAAAACAGCTGGGGCCACAAC
TTTGGTGAAGAAGGATATATTCGGATGGCAAGAAATAAAGGAAATCATTGTGGGATTGCTAGCTTTCCC
TCTTACCCAGAAATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199739
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199739.1
RefSeq Size 3957 bp
RefSeq ORF 846 bp
Locus ID 1520
UniProt ID P25774
Protein Families Druggable Genome, Protease
Protein Pathways Antigen processing and presentation, Lysosome
MW 31.6 kDa
Gene Summary The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. The mature protein cleaves the invariant chain of MHC class II molecules in endolysosomal compartments and enables the formation of antigen-MHC class II complexes and the proper display of extracellular antigenic peptides by MHC-II. The mature protein also functions as an elastase over a broad pH range. When secreted from cells, this protein can remodel components of the extracellular matrix such as elastin, collagen, and fibronectin. This gene is implicated in the pathology of many inflammatory and autoimmune diseases and, given its elastase activity, plays a significant role in some pulmonary diseases. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2020]
Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, so encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...