BAT4 (GPANK1) (NM_001199237) Human Untagged Clone

CAT#: SC331270

GPANK1 (untagged) - Homo sapiens G patch domain and ankyrin repeats 1 (GPANK1), transcript variant 1



  "NM_001199237" in other vectors (2)

CNY 3,420.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GPANK1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANKRD59; BAT4; D6S54E; G5; GPATCH10
Vector pCMV6-Entry
Sequence Data
>SC331270 representing NM_001199237.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCGGCCCTTGCTCATCACCTTCACCCCAGCCACTGACCCCAGCGACCTCTGGAAGGATGGGCAG
CAGCAGCCACAGCCCGAGAAGCCAGAGTCCACCCTGGATGGGGCTGCAGCCCGAGCTTTCTATGAGGCC
CTGATTGGGGATGAGAGCAGCGCTCCTGACTCCCAGAGATCTCAGACTGAACCTGCCAGAGAAAGAAAG
AGAAAGAAAAGAAGAATAATGAAGGCACCAGCAGCAGAAGCAGTGGCAGAAGGAGCATCAGGAAGACAT
GGACAAGGGAGATCCCTTGAGGCTGAGGATAAGATGACTCACCGGATACTGAGGGCAGCCCAGGAGGGG
GACCTGCCAGAACTTAGGAGACTGCTGGAACCGCATGAGGCAGGAGGAGCTGGGGGGAATATCAACGCC
CGGGATGCCTTCTGGTGGACCCCACTGATGTGTGCTGCTCGAGCGGGCCAGGGGGCAGCTGTGAGCTAT
CTCCTGGGCCGTGGGGCTGCCTGGGTGGGGGTCTGTGAGCTGAGTGGCAGGGATGCGGCTCAGCTCGCT
GAAGAAGCTGGCTTCCCTGAGGTAGCCCGCATGGTCAGGGAGAGCCATGGAGAGACAAGGAGCCCGGAA
AACCGGTCTCCTACTCCCTCCCTCCAGTACTGCGAGAACTGTGACACCCACTTCCAAGATTCCAACCAC
CGCACATCCACTGCTCACCTGCTGTCACTGTCGCAGGGTCCTCAGCCTCCCAACCTTCCACTTGGGGTG
CCCATCTCCAGCCCGGGCTTCAAACTGCTGCTGAGGGGGGGCTGGGAGCCAGGAATGGGGCTGGGACCC
CGGGGTGAGGGCCGTGCCAATCCCATCCCCACTGTCCTCAAGAGGGACCAGGAAGGACTAGGCTACAGA
TCAGCACCCCAGCCCCGAGTGACACATTTCCCAGCTTGGGATACCCGAGCTGTGGCTGGGAGGGAGAGA
CCCCCTCGGGTGGCCACACTGAGCTGGAGGGAGGAGAGAAGGAGGGAGGAGAAAGACAGGGCTTGGGAG
CGGGATCTAAGGACTTACATGAACCTCGAGTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199237
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199237.1
RefSeq Size 2793 bp
RefSeq ORF 1071 bp
Locus ID 7918
UniProt ID O95872
MW 39.3 kDa
Gene Summary This gene is located in a cluster of HLA-B-associated transcripts, which is included in the human major histocompatability complex III region. This gene encodes a protein which is thought to play a role in immunity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longest transcript.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...