SPINK6 (NM_001195290) Human Untagged Clone
CAT#: SC331180
SPINK6 (untagged) - Homo sapiens serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BUSI2; UNQ844 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331180 representing NM_001195290.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAACTGTCAGGCATGTTTCTGCTCCTCTCTCTGGCTCTTTTCTGCTTTTTAACAGGTGTCTTCAGT CAGGGAGGACAGGTTGACTGTGGTGAGTTCCAGGACCCCAAGGTCTACTGCACTCGGGAATCTAACCCA CACTGTGGCTCTGATGGCCAGACATATGGCAATAAATGTGCCTTCTGTAAGGCCATAGTGAAAAGTGGT GGAAAGATTAGCCTAAAGCATCCTGGAAAATGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195290 |
Insert Size | 243 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001195290.1 |
RefSeq Size | 610 bp |
RefSeq ORF | 243 bp |
Locus ID | 404203 |
UniProt ID | Q6UWN8 |
Protein Families | Secreted Protein, Transmembrane |
MW | 8.6 kDa |
Gene Summary | The protein encoded by this gene is a Kazal-type serine protease inhibitor that acts on kallikrein-related peptidases in the skin. Two transcript variants the same protein have been found for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233241 | SPINK6 (Myc-DDK tagged) - Homo sapiens serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 2 |
CNY 1,200.00 |
|
RG233241 | SPINK6 (tGFP-tagged) - Homo sapiens serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 2 |
CNY 4,370.00 |