CD4 (NM_001195017) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CD4mut; IMD79; OKT4D
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331174 representing NM_001195017. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAAC CTCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCC ACTCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGTTTG AAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCG GGGATGTGGCAGTGTCTGCTGAGTGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCC ACATGGTCCACCCCGGTGCAGCCAATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTC ATTGGGCTAGGCATCTTCTTCTGTGTCAGGTGCCGGCACCGAAGGCGCCAAGCAGAGCGGATGTCTCAG ATCAAGAGACTCCTCAGTGAGAAGAAGACCTGCCAGTGTCCTCACCGGTTTCAGAAGACATGTAGCCCC ATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001195017
Insert Size	558 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001195017.2
RefSeq Size	2831 bp
RefSeq ORF	558 bp
Locus ID	920
Protein Families	Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane
Protein Pathways	Antigen processing and presentation, Cell adhesion molecules (CAMs), Hematopoietic cell lineage, Primary immunodeficiency, T cell receptor signaling pathway
MW	20.7 kDa
Gene Summary	This gene encodes the CD4 membrane glycoprotein of T lymphocytes. The CD4 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class II MHC molecules. The CD4 antigen is also a primary receptor for entry of the human immunodeficiency virus through interactions with the HIV Env gp120 subunit. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, granulocytes, as well as in various regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, May 2020] Transcript Variant: This variant (5) uses an alternate splice site, lacks two consecutive exons and initiates translation from a downstream, in-frame start codon, compared to variant 1. Variants 3, 4 and 5 encode isoform 3, which has a shorter N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.