MTRFR (NM_001194995) Human Untagged Clone
CAT#: SC331172
C12orf65 (untagged) - Homo sapiens chromosome 12 open reading frame 65 (C12orf65), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf65; COXPD7; SPG55 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331172 representing NM_001194995.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCACCGTGGGTTTATTTCATTTTCCTACACCACTGACCCGAATATGCCCGGCGCCATGGGGACTC CGGCTTTGGGAGAAGCTGACGTTGTTATCCCCAGGAATAGCTGTCACTCCGGTCCAGATGGCAGGCAAG AAGGACTACCCTGCACTGCTTTCCTTGGATGAGAATGAACTCGAAGAGCAGTTTGTGAAAGGACACGGT CCAGGGGGCCAGGCAACCAACAAAACCAGCAACTGCGTGGTGCTGAAGCACATCCCCTCAGGCATCGTT GTAAAGTGCCATCAGACAAGATCAGTTGATCAGAACAGAAAGCTAGCTCGGAAAATCCTACAAGAGAAA GTAGATGTTTTCTACAATGGTGAAAACAGTCCTGTTCACAAAGAAAAACGAGAAGCGGCGAAGAAAAAA CAAGAAAGGAAAAAAAGAGCAAAGGAAACCCTGGAAAAAAAGAAGCTACTTAAAGAACTGTGGGAGTCA AGTAAAAAGGTCCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001194995 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001194995.1 |
RefSeq Size | 1901 bp |
RefSeq ORF | 501 bp |
Locus ID | 91574 |
UniProt ID | Q9H3J6 |
MW | 18.8 kDa |
Gene Summary | This nuclear gene encodes a mitochondrial matrix protein that appears to contribute to peptide chain termination in the mitochondrial translation machinery. Two different 1 bp deletions (resulting in the same premature stop codon)result in decreased mitochondrial translation, decreased levels of oxidative phosphorylation complexes and encepthalomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233342 | C12orf65 (Myc-DDK tagged) - Homo sapiens chromosome 12 open reading frame 65 (C12orf65), transcript variant 3 |
CNY 1,200.00 |
|
RG233342 | C12orf65 (tGFP-tagged) - Homo sapiens chromosome 12 open reading frame 65 (C12orf65), transcript variant 3 |
CNY 4,370.00 |