Claudin 15 (CLDN15) (NM_001185080) Human Untagged Clone

CAT#: SC331133

CLDN15 (untagged) - Homo sapiens claudin 15 (CLDN15), transcript variant 1



  "NM_001185080" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CLDN15 Antibody
    • 100 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331133 representing NM_001185080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGATGGCTGTGGAAACCTTTGGCTTCTTCATGGCAACTGTGGGGCTGCTGATGCTGGGGGTGACT
CTGCCAAACAGCTACTGGCGAGTGTCCACTGTGCACGGGAACGTCATCACCACCAACACCATCTTCGAG
AACCTCTGGTTTAGCTGTGCCACCGACTCCCTGGGCGTCTACAACTGCTGGGAGTTCCCGTCCATGCTG
GCCCTCTCTGGGTATATTCAGGCCTGCCGGGCACTCATGATCACCGCCATCCTCCTGGGCTTCCTCGGC
CTCTTGCTAGGCATAGCGGGCCTGCGCTGCACCAACATTGGGGGCCTGGAGCTCTCCAGGAAAGCCAAG
CTGGCGGCCACCGCAGGGGCCCTCCACATTCTGGCCGGTATCTGCGGGATGGTGGCCATCTCCTGGTAC
GCCTTCAACATCACCCGGGACTTCTTCGACCCCTTGTACCCCGGAACCAAGTACGAGCTGGGCCCCGCC
CTCTACCTGGGGTGGAGCGCCTCACTGATCTCCATCCTGGGTGGCCTCTGCCTCTGCTCCGCCTGCTGC
TGCGGCTCTGACGAGGACCCAGCCGCCAGCGCCCGGCGGCCCTACCAGGCTCCAGTGTCCGTGATGCCC
GTCGCCACCTCGGACCAAGAAGGCGACAGCAGCTTTGGCAAATACGGCAGAAACGCCTACGTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001185080
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001185080.1
RefSeq Size 2145 bp
RefSeq ORF 687 bp
Locus ID 24146
UniProt ID P56746
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
MW 24.4 kDa
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...