DOK7 (NM_001256896) Human Untagged Clone

CAT#: SC331111

DOK7 (untagged) - Homo sapiens docking protein 7 (DOK7), transcript variant 3



  "NM_001256896" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DOK7 mouse monoclonal antibody, clone OTI1A9 (formerly 1A9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C4orf25; CMS1B; CMS10; FADS3
Vector pCMV6-Entry
Sequence Data
>SC331111 representing NM_001256896.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGGTGCCTCAAGGCCACCCCCCAAGCCGCTGCGTCCGCGGCAGCTGCAGGAGGTTGGCCGCCAG
AGCTCCTCGGACAGCGGCATCGCCACTGGCAGCCACTCCTCTTACTCCAGCAGCCTCTCGTCCTACGCG
GGCAGCAGCCTGGACGTGTGGCGGGCCACAGATGAACTGGGCTCACTGCTCAGCCTGCCAGCAGCGGGG
GCCCCCGAGCCCAGCCTGTGCACCTGCCTGCCCGGGACAGTCGAGTACCAGGTGCCCACCTCCCTGCGG
GCCCACTATGACACACCACGCAGCCTTTGCCTGGCTCCTAGAGACCACAGCCCCCCCTCACAGGGCAGC
CCCGGCAACAGTGCGGCCAGGGACTCAGGCGGCCAGACGTCCGCCGGGTGTCCCTCTGGCTGGCTGGGC
ACGAGACGGCGGGGCCTGGTGATGGAGGCCCCCCAGGGCAGCGAGGCCACACTGCCTGGCCCTGCCCCT
GGCGAGCCCTGGGAAGCAGGCGGCCCCCACGCGGGGCCACCCCCGGCTTTCTTTTCGGCATGTCCAGTC
TGTGGAGGACTCAAGGTAAACCCCCCTCCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256896
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256896.1
RefSeq Size 2281 bp
RefSeq ORF 585 bp
Locus ID 285489
UniProt ID Q18PE1
MW 19.7 kDa
Gene Summary The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (3) uses an alternate internal promoter and differs in the 3' UTR and coding sequence compared to variant 4. The encoded isoform (3) is significantly shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...