SERPINB8 (NM_001276490) Human Untagged Clone

CAT#: SC331065

SERPINB8 (untagged) - Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 4



  "NM_001276490" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SERPINB8 mouse monoclonal antibody,clone OTI8F10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C18orf53; CAP2; PI-8; PI8; PSS5
Vector pCMV6-Entry
Sequence Data
>SC331065 representing NM_001276490.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCTTTAAAACCAACGAGGAAAAAAAGACAGTGCAGATGATGTTTAAGGAAGCTAAGTTTAAAATG
GGGTATGCGGATGAGGTACACACCCAGGTCCTGGAGCTGCCCTATGTGGAAGAGGAGCTGAGCATGGTC
ATTCTGCTTCCCGATGACAACACGGACCTCGCCGTGGTGGAAAAAGCACTTACATATGAGAAATTCAAA
GCCTGGACAAATTCAGAAAAGTTGACAAAAAGTAAGGTTCAAGTTTTCCTTCCCAGATTAAAGCTGGAG
GAGAGTTATGACTTGGAGCCTTTCCTTCGAAGATTAGGAATGATCGATGCTTTTGACGAAGCCAAGGCA
GACTTTTCTGGAATGTCAACTGAGAAGAATGTGCCTCTGTCCAAGGTTGCCCACAAGTGCTTCGTGGAG
GTCAATGAGGAAGGCACAGAGGCTGCCGCAGCCACTGCTGTGGTCAGGAATTCCCGGTGCAGCAGAATG
GAGCCAAGATTCTGTGCAGACCACCCTTTTCTTTTCTTCATCAGGCACCACAAAACCAACTGCATCTTG
TTCTGTGGCAGGTTCTCTTCTCCGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001276490
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276490.1
RefSeq Size 3212 bp
RefSeq ORF 579 bp
Locus ID 5271
UniProt ID P50452
Protein Families Druggable Genome
MW 22.1 kDa
Gene Summary The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (4) uses an alternate splice junction in the 5' UTR and lacks the alternate exon containing the translation start site compared to variant 2. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...