RGS3 (NM_001276262) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	C2PA; RGP3
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331036 representing NM_001276262. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGAACAAGCTGGGGATCTTCAGACGGCGGAATGAGTCCCCTGGAGCCCCTCCCGCGGGCAAGGCA GACAAAATGATGAAGTCATTCAAGCCCACCTCAGAGGAAGCCCTCAAGTGGGGCGAGTCCTTGGAGAAG CTGCTGGTTCACAAATACGGGTTAGCAGTGTTCCAAGCCTTCCTTCGCACTGAGTTCAGTGAGGAGAAT CTGGAGTTCTGGTTGGCTTGTGAGGACTTCAAGAAGGTCAAGTCACAGTCCAAGATGGCATCCAAGGCC AAGAAGATCTTTGCTGAATACATCGCGATCCAGGCATGCAAGGAGGTCAACCTGGACTCCTACACGCGG GAGCACACCAAGGACAACCTGCAGAGCGTCACGCGGGGCTGCTTCGACCTGGCACAGAAGCGCATCTTC GGGCTCATGGAAAAGGACTCGTACCCTCGCTTTCTCCGTTCTGACCTCTACCTGGACCTTATTAACCAG AAGAAGATGAGTCCCCCGCTTTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001276262
Insert Size	507 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001276262.1
RefSeq Size	1459 bp
RefSeq ORF	507 bp
Locus ID	5998
UniProt ID	P49796
Protein Families	Druggable Genome
Protein Pathways	Axon guidance
MW	19.5 kDa
Gene Summary	This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (9) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR, lacks a large portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 6. The encoded isoform (4, also known as RGS3S in PubMedID:11330340) is significantly shorter at the N-terminus, compared to isoform 6. Both variants 4 and 9 encode isoform 4.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.