RIT2 (NM_001272077) Human Untagged Clone

CAT#: SC331034

RIT2 (untagged) - Homo sapiens Ras-like without CAAX 2 (RIT2), transcript variant 2



  "NM_001272077" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RIT2 mouse monoclonal antibody, clone OTI4B5 (formerly 4B5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RIBA; RIN; ROC2
Vector pCMV6-Entry
Sequence Data
>SC331034 representing NM_001272077.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGTAGAAAATGAAGCCAGCTGCTCCCCGGGCAGCGCATCAGGCGGGTCCAGAGAGTACAAGGTG
GTAATGCTGGGAGCAGGGGGAGTTGGTAAAAGCGCAATGACAATGCAGTTTATTAGTCATCAGTTCCCT
GATTATCATGACCCTACTATAGAAGATGCTTATAAGACCCAGGTCAGGATTGACAATGAGCCAGCTTAC
TTGGACATCTTGGACACTGCTGGCCAGGCAGAATTCACAGCCATGCGGGAGCAGTACATGCGAGGTGGG
GAAGGCTTCATCATCTGCTACTCCGTCACTGACCGTCAATCATTTCAGGAGGCTGCCAAGTTTAAAGAG
CTCATTTTTCAGGTCCGCCACACCTATGAAATTCCCCTGGTGCTGGTGGGTAACAAAATTGATCTGGAA
CAGTTCCGCCAGCCTACACTGAAAGAGTTTGGAAGGGAAGAATTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001272077
Insert Size 462 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272077.1
RefSeq Size 1166 bp
RefSeq ORF 462 bp
Locus ID 6014
UniProt ID Q99578
MW 17.3 kDa
Gene Summary RIN belongs to the RAS (HRAS; MIM 190020) superfamily of small GTPases (Shao et al., 1999 [PubMed 10545207]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) contains an alternate internal exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...