HBLD1 (ISCA2) (NM_001272007) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	c14_5557; HBLD1; ISA2; MMDS4
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331022 representing NM_001272007. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGCCGCCTGGGGGTCGTCCCTAACGGCCGCGACGCAGAGAGCGGTCACTCCCTGGCCGAGGGGC AGGCTCCTCACGGCCTCCCTGGGACCCCAGGCGCGTCGGGAGGCGTCGTCCTCCAGCCCCGAGGCCGGC GAAGGGCAGATCCGCCTCACAGACAGTTGCGTCCAGGGTATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001272007
Insert Size	183 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001272007.1
RefSeq Size	972 bp
RefSeq ORF	183 bp
Locus ID	122961
UniProt ID	Q86U28
MW	6.2 kDa
Gene Summary	The protein encoded by this gene is an A-type iron-sulfur cluster (ISC) protein found in mitochondria. The encoded protein appears to be involved in the maturation of mitochondrial iron-sulfur proteins. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.