Rab4 (RAB4A) (NM_001271998) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HRES-1; HRES-1/RAB4; HRES1; RAB4
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331020 representing NM_001271998. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATATCACCAGATGCCCGAATGCTAGCGAGCCAGAACATTGTGATCATCCTTTGTGGAAACAAGAAG GACCTGGATGCAGATCGTGAAGTTACCTTCTTAGAAGCCTCCAGATTTGCTCAAGAAAATGAGCTGATG TTTTTGGAAACAAGTGCGCTCACAGGGGAGAATGTAGAAGAGGCTTTTGTACAGTGTGCAAGAAAAATA CTTAACAAAATCGAATCAGGTGAGCTGGACCCAGAAAGAATGGGCTCAGGTATTCAGTACGGAGATGCT GCCTTGAGACAGCTGAGGTCACCGCGGCGCGCACAGGCCCCGAACGCTCAGGAGTGTGGTTGTTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001271998
Insert Size	342 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001271998.1
RefSeq Size	2822 bp
RefSeq ORF	342 bp
Locus ID	5867
UniProt ID	P20338
Protein Families	Druggable Genome
Protein Pathways	Endocytosis
MW	12.5 kDa
Gene Summary	This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) has multiple differences in the coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.