Thymidine Kinase 2 (TK2) (NM_001271935) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	MTDPS2; MTTK; PEOB3; SCA31
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331010 representing NM_001271935. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGTGCGTTCTGCCAGCGTCCTAGCAGTGATAAAGAACAGGAAAAAGAGAAAAAATCAGTGATCTGT GTCGAGGGCAATATTGCAAGTGGGAAGACGACATGCCTGGAATTCTTCTCCAACGCGACAGACGTCGAG GTGTTAACGGAGCCTGTGTCCAAGTGGAGAAATGTCCGTGGCCACAATCCTCTGGGCCTGATGTACCAC GATGCCTCTCGCTGGGGTCTTACGCTACAGACTTATGTGCAGCTCACCATGCTGGACAGGCATACTCGT CCTCAGGTGTCATCTGTACGGTTGATGGAGAGGTCGATTCACAGCGCAAGATACATTTTTGTAGAAAAC CTGTATAGAAGGAATACCTGGAAGCAATTCACCATCTCCATGAGGAGTGGCTCATCAAAGGCAGCCTTT TCCCCATGGCAGCCCCTGTTCTGGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001271935
Insert Size	441 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001271935.1
RefSeq Size	4528 bp
RefSeq ORF	441 bp
Locus ID	7084
UniProt ID	O00142
Protein Families	Druggable Genome
Protein Pathways	Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
MW	16.9 kDa
Gene Summary	This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region and two internal exons, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (6) is not localized to mitochondria, and it has a distinct N-terminus, lacks an internal segment and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.