SEC11A (NM_001271922) Human Untagged Clone

CAT#: SC331008

SEC11A (untagged) - Homo sapiens SEC11 homolog A (S. cerevisiae) (SEC11A), transcript variant 3



  "NM_001271922" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SEC11A mouse monoclonal antibody,clone OTI1A12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 1810012E07Rik; SEC11L1; sid2895; SPC18; SPCS4A
Vector pCMV6-Entry
Sequence Data
>SC331008 representing NM_001271922.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGTCTCTAGACTTTTTGGACGATGTGCGGCGGATGAACAAGCGGCAGCTCTATTATCAAGTCCTA
AATTTTGGAATGATTGTCTCATCGGCACTAATGATCTGGAAGGGGTTAATGGTAATAACTGGAAGTGAA
AGTCCGATTGTAGTGGTGCTCAGTGGCAGCATGGAACCTGCATTTCATAGAGGAGATCTTCTCTTTCTA
ACAAATCGAGTTGAAGATCCCATACGAGTGGGAGAAATTGTTGTTTTTAGGATAGAAGGAAGAGAGATT
CCTATAGTTCACCGAGTCTTGAAGATTCATGAAAAGCAAAATGGGCATATCAAGTTTTTGACCAAAGGA
GATAATAATGCGGTTGATGACCGAGGCCTCTATAAACAAGGACAACATTGGCTAGAGAAAAAAGATGTT
GTGGGGAGAGCCAGGGGTATGCAGTTCTCTTTTTGCTGGGTTTATTCGTGCTGGTTCATCGTGAGTAAG
AAGCCTGCCTTGCTGTTCCTGGGAAGATGCCATAGTTTTCGTTACTGGATGTTTGGAGTAGATACTGGT
CTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271922
Insert Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271922.1
RefSeq Size 1366 bp
RefSeq ORF 558 bp
Locus ID 23478
UniProt ID P67812
Protein Families Druggable Genome, Protease, Transmembrane
Protein Pathways Protein export
MW 21.5 kDa
Gene Summary This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) uses an alternate in-frame exon and lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (3) is longer and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...