AAGAB (NM_001271886) Human Untagged Clone

CAT#: SC330994

AAGAB (untagged) - Homo sapiens alpha- and gamma-adaptin binding protein (AAGAB), transcript variant 3



  "NM_001271886" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
AAGAB Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KPPP1; p34; PPKP1; PPKP1A
Vector pCMV6-Entry
Sequence Data
>SC330994 representing NM_001271886.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATCTTGGTCTGCGATAGAGTGTCTGAAGATGGTATAAACCGACAAAAAGCTCAAGAATGGTGCATC
AAACATGGCTTTGAATTGGTAGAACTTAGTCCAGAGGAGTTGCCTGAGGAGGATGATGACTTCCCAGAA
TCTACAGGAGTAAAGCGAATTGTCCAAGCCCTGAATGCCAATGTGTGGTCCAATGTAGTGATGAAGAAT
GATAGGAACCAAGGCTTTAGCCTTCTCAACTCATTGACTGGAACAAACCATAGCATTGGGTCAGCAGAT
CCCTGTCACCCAGAGCAACCCCATTTGCCAGCAGCAGATAGTACTGAATCCCTCTCTGATCATCGGGGT
GGTGCATCTAACACAACAGATGCCCAGGTTGATAGCATTGTGGATCCCATGTTAGATCTGGATATTCAA
GAATTAGCCAGTCTTACCACTGGAGGAGGAGATGTGGAGAATTTTGAAAGACTCTTTTCAAAGTTAAAG
GAAATGAAAGACAAGGCTGCGACGCTTCCTCATGAGCAAAGAAAAGTGCATGCAGAAAAGGTGGCCAAA
GCATTCTGGATGGCAATCGGGGGAGACAGAGATGAAATTGAAGGCCTTTCATCTGATGAAGAGCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271886
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271886.1
RefSeq Size 3344 bp
RefSeq ORF 621 bp
Locus ID 79719
UniProt ID Q6PD74
MW 22.7 kDa
Gene Summary The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) contains an alternatively spliced 5' terminal exon, which causes translation initiation from an in-frame downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...