HIGD1B (NM_001271880) Human Untagged Clone

CAT#: SC330992

HIGD1B (untagged) - Homo sapiens HIG1 hypoxia inducible domain family, member 1B (HIGD1B), transcript variant 2



  "NM_001271880" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLST11240; CLST11240-15
Vector pCMV6-Entry
Sequence Data
>SC330992 representing NM_001271880.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGCTAACAGACGCTGGTGGGTACCACCTGACGACGAAGACTGTGTGTCTGAGAAGCTCCTGAGG
AAGACTCGGGAATCTCCACTGGTGCCTATAGGCTTAGGAGGCTGCTTGGTGGTAGCAGCATACAGGATT
TACCGGCTGAGGTCTCGTGGTTCCACCAAGATGTCCATACACCTGATTCACACCCGAGTGGCAGCGCAG
GCCTGTGCAGTGGGTGCAATCATGCTAGGTGCTGTGTACACAATGTACAGCGATTACGTCAAGAGGATG
GCACAGGATGCTGGAGAGAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001271880
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271880.1
RefSeq Size 558 bp
RefSeq ORF 300 bp
Locus ID 51751
UniProt ID Q9P298
Protein Families Transmembrane
MW 11.1 kDa
Gene Summary This gene encodes a member of the hypoxia inducible gene 1 (HIG1) domain family. The encoded protein is localized to the cell membrane and has been linked to tumorigenesis and the progression of pituitary adenomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...