YL1 (VPS72) (NM_001271087) Human Untagged Clone

CAT#: SC330923

VPS72 (untagged) - Homo sapiens vacuolar protein sorting 72 homolog (S. cerevisiae) (VPS72), transcript variant 1



  "NM_001271087" in other vectors (2)

CNY 3,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-VPS72 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFL1; Swc2; TCFL1; YL-1; YL1
Vector pCMV6-Entry
Sequence Data
>SC330923 representing NM_001271087.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTTTGGCTGGGGGCCGGGCACCCCGGAAGACCGCTGGGAACCGGCTTTCTGGGCTTTTGGAGGCA
GAGGAGGAAGATGAGTTCTACCAGACGACTTATGGGGGTTTCACAGAGGAATCCGGAGATGATGAGTAT
CAAGGGGACCAGTCAGACACAGAGGACGAAGTGGACTCTGACTTTGACATTGATGAAGGGGATGAACCA
TCCAGTGATGGAGAAGCAGAAGAGCCAAGAAGGAAGCGCCGAGTAGTCACCAAGGCCTATAAGGAACCT
CTCAAGAGCTTAAGGCCTCGAAAGGTCAACACCCCGGCTGGTAGCTCTCAGAAGGCGCGAGAAGAGAAG
GCACTACTGCCATTAGAACTACAAGATGACGGCTCTGACAGTCGGAAGTCTATGCGTCAGTCTACAGCT
GAGCATACACGACAAACGTTCCTTCGGGTACAGGAGAGGCAGGGCCAGTCAAGACGGCGAAAGGGGCCC
CACTGTGAGCGGCCACTAACCCAGGAGGAACTGCTCCGGGAGGCCAAGATCACAGAAGAGCTTAATTTA
CGGTCACTGGAGACATATGAGCGGCTCGAGGCTGATAAAAAGAAGCAGGTTCATAAGAAGCGGAAGTGC
CCCGGGCCCATAATCACCTATCATTCAGTGACAGTGCCACTTGTTGGGGAGCCAGGCCCCAAGGAAGAG
AACGTTGACATAGAAGGCTCTTTGTGTTTTTCCTTGTCTTTTGTCCTCAGACTTGATCCTGCTCCCTCG
GTGTCTGCATTGACTCCTCATGCTGGGACTGGACCCGTCAACCCCCCTGCTCGCTGCTCACGTACCTTC
ATCACTTTTAGTGATGATGCAACTTTCGAGGAATGGTTCCCCCAAGGGCGGCCCCCAAAAGTCCCTGTT
CGTGAGGTCTGTCCAGTGACCCATCGTCCAGCCCTATACCGGGACCCTGTTACAGACATACCCTATGCC
ACTGCTCGAGCCTTCAAGATCATTCGTGAGGCTTACAAGAAGTACATTACTGCCCATGGACTGCCGCCC
ACTGCCTCAGCCCTGGGCCCCGGCCCGCCACCTCCTGAGCCCCTCCCTGGCTCTGGGCCCCGAGCCTTG
CGCCAGAAAATTGTCATTAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001271087
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271087.1
RefSeq Size 1579 bp
RefSeq ORF 1128 bp
Locus ID 6944
UniProt ID Q15906
Protein Families Transcription Factors
MW 41.8 kDa
Gene Summary The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...