MAX (NM_001271068) Human Untagged Clone
CAT#: SC330921
MAX (untagged) - Homo sapiens MYC associated factor X (MAX), transcript variant 7
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
MAX mouse monoclonal antibody,clone OTI14G1
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHd4 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330921 representing NM_001271068.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGCTGACAAACGGGCTCATCATAATGCACTGGAA CGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGA GAGAAGCTCTATTTCCTCTTTTGGAAATTGTGTACTCCTGTCCTTCATCGTCAAAGTTTGATGCAGAAA TGCCACACCTTCATTTCAAGCTACCAAGTGCACAAGAAAAAAGAATGCAAGATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271068 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271068.1 |
RefSeq Size | 910 bp |
RefSeq ORF | 264 bp |
Locus ID | 4149 |
UniProt ID | P61244 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | MAPK signaling pathway, Pathways in cancer, Small cell lung cancer |
MW | 10.4 kDa |
Gene Summary | The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (7) lacks two alternate in-frame exons in the coding region and includes an alternate 3' terminal exon compared to variant 1. It encodes isoform g which is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...