Epigen (EPGN) (NM_001270991) Human Untagged Clone
CAT#: SC330903
EPGN (untagged) - Homo sapiens epithelial mitogen (EPGN), transcript variant 3
CNY 2,950.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALGV3072; EPG; PRO9904 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330903 representing NM_001270991.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCA GCCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGCTGACAACATAGAAGGACCCATAGCCTTGAAG TTCTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAACGGTGCTTGTGCATTCCACCATGAG CTAGAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAAGGTGTCTAAAATTGAAATCGCCT TACAATGTCTGTTCTGGAGAAAGACGACCACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270991 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270991.1 |
RefSeq Size | 2542 bp |
RefSeq ORF | 312 bp |
Locus ID | 255324 |
UniProt ID | Q6UW88 |
Protein Families | Transmembrane |
MW | 11.3 kDa |
Gene Summary | The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (3) uses alternate in-frame splice sites in two exons in the coding region compared to variant 1. It encodes isoform 3 (also known as isoform F) which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...