NOSIP (NM_001270960) Human Untagged Clone

CAT#: SC330901

NOSIP (untagged) - Homo sapiens nitric oxide synthase interacting protein (NOSIP), transcript variant 2



  "NM_001270960" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NOSIP rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-25
Vector pCMV6-Entry
Sequence Data
>SC330901 representing NM_001270960.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACGCGGCATGGCAAGAACTGCACCGCAGGGGCCGTCTACACCTACCACGAGAAGAAGAAGGACACA
GCGGCCTCGGGCTATGGGACCCAGAACATTCGACTGAGCCGGGATGCCGTGAAGGACTTCGACTGCTGT
TGTCTCTCCCTGCAGCCTTGCCACGATCCTGTTGTCACCCCAGATGGCTACCTGTATGAGCGTGAGGCC
ATCCTGGAGTACATTCTGCACCAGAAGAAGGAGATTGCCCGGCAGATGAAGGCCTACGAGAAGCAGCGG
GGCACCCGGCGCGAGGAGCAGAAGGAGCTTCAGCGGGCGGCCTCGCAGGACCATGTGCGGGGCTTCCTG
GAGAAGGAGTCGGCTATCGTGAGCCGGCCCCTCAACCCTTTCACAGCCAAGGCCCTCTCGGGCACCAGC
CCAGATGATGTCCAACCTGGGCCCAGTGTGGGTCCTCCAAGTAAGGACAAGGACAAAGTGCTGCCCAGC
TTCTGGATCCCGTCGCTGACGCCCGAAGCCAAGGCCACCAAGCTGGAGAAGCCGTCCCGCACGGTGACC
TGCCCCATGTCAGGGAAGCCCCTGCGCATGTCGGACCTGACGCCCGTGCACTTCACACCGCTAGACAGC
TCCGTGGACCGCGTGGGGCTCATCACCCGCAGCGAGCGCTACGTGTGTGCCGTGACCCGCGACAGCCTG
AGCAACGCCACCCCCTGCGCTGTGCTGCGGCCCTCTGGGGCTGTGGTCACCCTCGAATGCGTGGAGAAG
CTGATTCGGAAGGACATGGTGGACCCTGTGACTGGAGACAAACTCACAGACCGCGACATCATCGTGCTG
CAGCGGGGCGGTACCGGCTTCGCGGGCTCCGGAGTGAAGCTGCAAGCGGAGAAATCACGGCCGGTGATG
CAGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270960
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270960.1
RefSeq Size 1248 bp
RefSeq ORF 906 bp
Locus ID 51070
UniProt ID Q9Y314
MW 33.2 kDa
Gene Summary The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...