BRP44L (MPC1) (NM_001270879) Human Untagged Clone

CAT#: SC330880

MPC1 (untagged) - Homo sapiens mitochondrial pyruvate carrier 1 (MPC1), transcript variant 2



  "NM_001270879" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MPC1 / BRP44L antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRP44L; CGI-129; MPYCD; SLC54A1
Vector pCMV6-Entry
Sequence Data
>SC330880 representing NM_001270879.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAAAGTCTCCAGAGATTATCAGTGGGCGGATGACATTTGCCCTCTGTTGCTATTCTTTGACATTC
ATGAGATTTGCCTACAAGGTACAGCCTCGGAACTGGCTTCTGTTTGCATGCCACGCAACAAATGAAGTA
GCCCAGCTCATCCAGGGAGGGCGGCTTATCAAACACGAGATGACTAAAACGGCATCTGCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001270879
Insert Size 201 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270879.1
RefSeq Size 1193 bp
RefSeq ORF 201 bp
Locus ID 51660
MW 7.5 kDa
Gene Summary The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. This results in a distinct 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...