Josephin 2 (JOSD2) (NM_001270686) Human Untagged Clone

CAT#: SC330866

JOSD2 (untagged) - Homo sapiens Josephin domain containing 2 (JOSD2), transcript variant 5



  "NM_001270686" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-JOSD2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SBBI54
Vector pCMV6-Entry
Sequence Data
>SC330866 representing NM_001270686.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCAGGCCCCGGGAGCACAGCCGAGCCCACCCACCGTGTACCACGAACGGCAGCGCCTGGAGCTG
TGTGCTGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATC
TGCAAGAGGTTGGCCCCAGACTCCCGGCTGAACCCTCATCGCAGCCTCCTGGGCACCGGCAACTATGAT
GTCAATGTGATCATGGCCGCTCTGCAGGGGCTGGGCCTGGCCGCCGTGTGGTGGGACAGGAGGAGGCCC
CTGTCCCAGCTGGCCCTGCCCCAGGTACTGGGGCTGATCCTGAACCTGCCCTCGCCCGTGTCGCTGGGG
CTGCTGTCACTGCCGCTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGTGTCTACTACAAC
CTGGACTCCAAGCTGCGGGCGCCCGAGGCCCTGGGGGATGAGGACGGAGTCAGGGCCTTCCTGGCGGCT
GCGCTGGCCCAGGGCCTGTGCGAGGTGCTGCTGGTAGTGACCAAGGAGGTGGAGGAGAAGGGCAGCTGG
CTGCGGACAGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270686
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270686.1
RefSeq Size 860 bp
RefSeq ORF 567 bp
Locus ID 126119
UniProt ID Q8TAC2
Protein Families Druggable Genome
MW 20.8 kDa
Gene Summary This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...