RPL13A (NM_001270491) Human Untagged Clone

CAT#: SC330852

RPL13A (untagged) - Homo sapiens ribosomal protein L13a (RPL13A), transcript variant 2



  "NM_001270491" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPL13A rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms L13A; TSTA1
Vector pCMV6-Entry
Sequence Data
>SC330852 representing NM_001270491.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACACCAACCCTTCCCGAGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTG
CGAGGTATGCTGCCCCACAAAACCAAGCGAGGCCAGGCCGCTCTGGACCGTCTCAAGGTGTTTGACGGC
ATCCCACCGCCCTACGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTCGTGCGTCTGAAG
CCTACAAGAAAGTTTGCCTATCTGGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCAGTGACA
GCCACCCTGGAGGAGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGAGG
CTACGGAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATACACAGAGGTCCTCAAGACCCAC
GGACTCCTGGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270491
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270491.1
RefSeq Size 1120 bp
RefSeq ORF 429 bp
Locus ID 23521
UniProt ID P40429
Protein Pathways Ribosome
MW 16.7 kDa
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) lacks an internal exon, uses an alternate splice site and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...