LMO1 (NM_001270428) Human Untagged Clone

CAT#: SC330832

LMO1 (untagged) - Homo sapiens LIM domain only 1 (rhombotin 1) (LMO1), transcript variant 2



  "NM_001270428" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
LMO1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RBTN1; RHOM1; TTG1
Vector pCMV6-Entry
Sequence Data
>SC330832 representing NM_001270428.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGTTGGACCAGGAGGACGGCGTGCCGATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGCTGT
GCGGGCTGTAACCGCAAGATCAAGGACCGCTATCTGCTGAAGGCATTGGACAAGTACTGGCACGAAGAC
TGCCTCAAGTGTGCCTGCTGTGACTGCCGCCTGGGCGAGGTGGGCTCCACCCTCTACACCAAGGCCAAC
CTCATCCTGTGCCGACGCGACTACCTGAGGCTCTTTGGCACCACAGGGAACTGTGCTGCTTGCAGCAAG
CTGATCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAACGTGTATCACCTCGACTGCTTCGCCTGC
CAGCTCTGCAACCAGAGATTTTGTGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGTCAG
ATGGACTATGAGGAAGGGCAGCTCAATGGCACCTTTGAATCCCAAGTTCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001270428
Insert Size 468 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270428.1
RefSeq Size 983 bp
RefSeq ORF 468 bp
Locus ID 4004
UniProt ID P25800
Protein Families Druggable Genome, Transcription Factors
MW 17.7 kDa
Gene Summary This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...