SLIRP (NM_001267863) Human Untagged Clone

CAT#: SC330797

SLIRP (untagged) - Homo sapiens SRA stem-loop interacting RNA binding protein (SLIRP), transcript variant 2



  "NM_001267863" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SLIRP Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf156; DC50; PD04872
Vector pCMV6-Entry
Sequence Data
>SC330797 representing NM_001267863.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTG
AGAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGA
AGGTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCA
GAAGAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTTCACACTAGA
AGGCCAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267863
Insert Size 324 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267863.1
RefSeq Size 414 bp
RefSeq ORF 324 bp
Locus ID 81892
UniProt ID Q9GZT3
MW 12.1 kDa
Gene Summary Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...