PAAF1 (NM_001267805) Human Untagged Clone

CAT#: SC330791

PAAF1 (untagged) - Homo sapiens proteasomal ATPase-associated factor 1 (PAAF1), transcript variant 3



  "NM_001267805" in other vectors (2)

CNY 3,610.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PAAF1 mouse monoclonal antibody, clone OTI1F11 (formerly 1F11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAAF; Rpn14; WDR71
Vector pCMV6-Entry
Sequence Data
>SC330791 representing NM_001267805.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGTGCCATGCTTCTTGTACAGTCTGCAGAACCGGAAACCATCTTTGTATGGCAGCCTGACTTGT
CAAGGAATTGGCCTAGATGGCATCCCAGAGGTTACAGCTTCAGAAGGATTTACTGTGAATGAAATAAAC
AAGAAAAGCATTCATATTTCATGTCCAAAGGAAAATGCATCTTCTAAGTTTTTGGCACCATATACTACT
TTTTCCAGAATTCATACAAAGAGTATAACATGCCTGGACATTTCCAGCAGAGGAGGTCTTGGTGTGTCT
TCTAGTACTGACGGGACCATGAAAATCTGGCAGGCTTCCAATGGAGAACTCAGGAGAGTATTGGAAGGA
CATGTGTTTGATGTGAATTGTTGCAGGTTTTTCCCATCAGGCCTTGTGGTCCTGAGTGGGGGAATGGAT
GCCCAGCTGAAGATATGGTCAGCTGAAGATGCTAGCTGCGTGGTGACCTTCAAAGGTCACAAAGGAGGT
ATCCTGGATACAGCCATCGTTGATCGGGGGAGGAATGTGGTGTCTGCTTCTCGAGATGGGACAGCACGA
CTTTGGGATTGTGGGCGCTCAGCCTGCTTGGGAGTCCTTGCAGATTGTGGTTCTTCTATCAATGGAGTG
GCGGTGGGTGCTGCTGACAACTCCATAAACCTTGGCTCCCCTGAGCAGATGCCCAGTGAACGGGAGGTT
GGAACAGAGGCCAAAATGCTGCTCTTGGCCCGGGAAGATAAGAAACTTCAGTGCTTGGGACTACAGAGC
AGGCAGCTGGTGTTCCTCTTTATTGGCTCAGACGCTTTCAACTGCTGTACTTTTCTCTCTGGCTTCTTG
CTATTGGCTGGGACTCAAGATGGAAACATTTATCAGCTGGATGTGAGGAGTCCAAGGGCTCCGGTACAA
GTCATCCACAGATCAGGAGCACCAGTTCTATCCCTGCTAAGTGTCAGAGATGGATTCATTGCTAGCCAA
GGTGATGGAAGCTGTTTTATTGTCCAGCAAGACTTAGACTATGTCACTGAGCTCACTGGGGCTGACTGT
GACCCTGTGTACAAGGTAGCCACATGGGAGAAGCAGATCTACACATGCTGTCGAGACGGTCTTGTACGA
CGCTACCAGCTTTCTGACCTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267805
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267805.1
RefSeq Size 1682 bp
RefSeq ORF 1128 bp
Locus ID 80227
UniProt ID Q9BRP4
MW 40.4 kDa
Gene Summary This gene encodes a WD repeat-containing protein involved in regulation of association of proteasome components. During HIV infection, the encoded protein is thought to promote provirus transcription through recruitment of the 19S regulatory complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (3) contains an alternate splicing structure in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...