Microsomal Glutathione S transferase 1 (MGST1) (NM_001267598) Human Untagged Clone
CAT#: SC330766
MGST1 (untagged) - Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant 8
CNY 2,950.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GST12; MGST; MGST-I |
Vector | pCMV6-Entry |
Sequence Data |
>SC330766 representing NM_001267598.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTTGACCTCACCCAGGTAATGGATGATGAAGTATTCATGGCTTTTGCATCCTATGCAACAATTATT CTTTCAAAAATGATGCTTATGAGTACTGCAACTGCATTCTATAGATTGACAAGAAAGGTTTTTGCCAAT CCAGAAGACTGTGTAGCATTTGGCAAAGGAGAAAATGCCAAGAAGTATCTTCGAACAGATGACAGAGTA GAACGTGTACGCAGAATCAAACAAACCCTGAGCATTTATCTTGCCTCTTCTATATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267598 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267598.1 |
RefSeq Size | 1509 bp |
RefSeq ORF | 264 bp |
Locus ID | 4257 |
UniProt ID | P10620 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
MW | 10 kDa |
Gene Summary | The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (8) differs in the 5' UTR and has an alternate exon in place of the last exon compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Microsomal Glutathione S transferase 1产品
Customer
Reviews
Loading...