CREM (NM_001267567) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CREM-2; hCREM-2; ICER
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330763 representing NM_001267567. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACAAATTCAGGAGCTCCTCCACCAGGTGCTACAATTGTACAGTACGCAGCACAATCAGCTGATGGC ACACAGCAGTTCTTTGTCCCAGGCAGCCAGGTTGTTGTTCAAGCTGCCACTGGTGACATGCCAACTTAC CAGATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTGCAC AGTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACAGGGAAGCT GCCAAAGAATGTCGACGTCGAAAGAAAGAATATGTAAAATGTCTGGAGAGCCGAGTTGCAGTGCTGGAA GTCCAGAACAAGAAGCTTATAGAGGAACTTGAAACCTTGAAAGACATTTGTTCTCCCAAAACAGATTAC TAG
Restriction Sites	SgfI-MluI
ACCN	NM_001267567
Insert Size	417 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001267567.1
RefSeq Size	1773 bp
RefSeq ORF	417 bp
Locus ID	1390
UniProt ID	Q03060
Protein Families	Druggable Genome, Transcription Factors
MW	15.1 kDa
Gene Summary	This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (28) has an alternate first exon in place of the first five exons compared to variant 1. The resulting isoform (28) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.