PDCD6 (NM_001267557) Human Untagged Clone
CAT#: SC330759
PDCD6 (untagged) - Homo sapiens programmed cell death 6 (PDCD6), transcript variant 3
CNY 2,950.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALG-2; ALG2; PEF1B |
Vector | pCMV6-Entry |
Sequence Data |
>SC330759 representing NM_001267557.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGCCTACTCTTACCGCCCCGGCCCTGGGGCCGGCCCTGGGCCTGCTGCAGGCGCGGCGCTGCCG GACCAGAGCTTCCTGTGGAACGTTTTCCAGAGGGTCGATAAAGACAGGAGTGGAGTGATATCAGACACC GAGCTTCAGCAAGCTCTCTCCAACGGCTACCGGCTCTCTGACCAGTTCCACGACATCCTCATTCGAAAG TTTGACAGGCAGGGACGGGGGCAGATTGCCTTCGACGACTTCATCCAGGGCTGCATCGTCCTGCAGAGG TTGACGGATATATTCAGACGTTACGACACGGATCAGGACGGCTGGATTCAGGTGTCGTACGAACAGTAC CTGTCCATGGTCTTCAGTATCGTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267557 |
Insert Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267557.1 |
RefSeq Size | 947 bp |
RefSeq ORF | 372 bp |
Locus ID | 10016 |
UniProt ID | O75340 |
Protein Families | Druggable Genome |
MW | 14 kDa |
Gene Summary | This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012] Transcript Variant: This variant (3) lacks two consecutive exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species. An upstream in-frame start codon is also present but is poorly conserved; use of the upstream start codon would result in a protein that is 32 aa longer. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...