PDCD6 (NM_001267557) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ALG-2; ALG2; PEF1B
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330759 representing NM_001267557. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGCCTACTCTTACCGCCCCGGCCCTGGGGCCGGCCCTGGGCCTGCTGCAGGCGCGGCGCTGCCG GACCAGAGCTTCCTGTGGAACGTTTTCCAGAGGGTCGATAAAGACAGGAGTGGAGTGATATCAGACACC GAGCTTCAGCAAGCTCTCTCCAACGGCTACCGGCTCTCTGACCAGTTCCACGACATCCTCATTCGAAAG TTTGACAGGCAGGGACGGGGGCAGATTGCCTTCGACGACTTCATCCAGGGCTGCATCGTCCTGCAGAGG TTGACGGATATATTCAGACGTTACGACACGGATCAGGACGGCTGGATTCAGGTGTCGTACGAACAGTAC CTGTCCATGGTCTTCAGTATCGTATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001267557
Insert Size	372 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001267557.1
RefSeq Size	947 bp
RefSeq ORF	372 bp
Locus ID	10016
UniProt ID	O75340
Protein Families	Druggable Genome
MW	14 kDa
Gene Summary	This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012] Transcript Variant: This variant (3) lacks two consecutive exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species. An upstream in-frame start codon is also present but is poorly conserved; use of the upstream start codon would result in a protein that is 32 aa longer. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.