PEAMT (PEMT) (NM_001267551) Human Untagged Clone

CAT#: SC330756

PEMT (untagged) - Homo sapiens phosphatidylethanolamine N-methyltransferase (PEMT), transcript variant 4



  "NM_001267551" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PEMT Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PEAMT; PEMPT; PEMT2; PLMT; PNMT
Vector pCMV6-Entry
Sequence Data
>SC330756 representing NM_001267551.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGAGATCTGGGAACCCGGGAGCCGAGGCAGACTTCTGCGTTATGACCCGGCTGCTGGGCTACGTG
GACCCCCTGGATCCCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATCCGCTCTACTGGAATGTG
GTTGCACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCTTCGGATCCCCCTACCTGGCCTGCTAC
TCTCTAAGCGTCACCATCCTGCTCCTGAACTTCCTGCGCTCGCACTGCTTCACGCAGGCCATGCTGAGC
CAGCCCAGGATGGAGAGCCTGGACACCCCCGCGGCCTACAGCCTGGGCCTCGCGCTCCTGGGACTGGGC
GTCGTGCTCGTGCTCTCCAGCTTCTTTGCACTGGGGTTCGCTGGAACTTTCCTAGGTGATTACTTCGGG
ATCCTCAAGGAGGCGAGAGTGACCGTGTTCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAAGC
ACAGCCAACTACCTGGGCTGGGCCATCATGCACGCCAGCCCCACGGGCCTGCTCCTGACGGTGCTGGTG
GCCCTCACCTACATAGTGGCTCTCCTATACGAAGAGCCCTTCACCGCTGAGATCTACCGGCAGAAAGCC
TCCGGGTCCCACAAGAGGAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267551
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267551.1
RefSeq Size 960 bp
RefSeq ORF 645 bp
Locus ID 10400
UniProt ID Q9UBM1
Protein Families Transmembrane
Protein Pathways Glycerophospholipid metabolism, Metabolic pathways
MW 23.7 kDa
Gene Summary Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region compared to variant 1. The resulting protein (isoform 4) is shorter but has the same N- and C-termini compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...