UCK (UCK1) (NM_001261450) Human Untagged Clone

CAT#: SC330716

UCK1 (untagged) - Homo sapiens uridine-cytidine kinase 1 (UCK1), transcript variant 3



  "NM_001261450" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-UCK1 mouse monoclonal antibody, clone OTI4C2 (formerly 4C2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms URK1
Vector pCMV6-Entry
Sequence Data
>SC330716 representing NM_001261450.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTTCGGCGGGAGGCGAAGACTGCGAGAGCCCCGCGCCGGAGGCCGACCGTCCGCACCAGCGGCCC
TTCCTGATAGGGTCGACCGTGTGTGAGAAGATCATGGAGTTGCTGGGACAGAACGAGGTGGAACAGCGG
CAGCGGAAGGTGGTCATCCTGAGCCAGGACAGGTTCTACAAGGTCCTGACGGCAGAGCAGAAGGCCAAG
GCCTTGAAAGGACAGTACAATTTTGACCATCCAGATGCCTTTGATAATGATTTGATGCACAGGACTCTG
AAGAACATCGTGGAGGGCAAAACGGTGGAGGTGCCGACCTATGATTTTGTGACACACTCAAGGTTACCA
GAGACCACGGTGGTCTACCCTGCGGACGTGGTTCTGTTTGAGGGCATCTTGGTGTTCTACAGCCAGGAG
ATCCGGGACATGTTCCACCTGCGCCTCTTCGTGGACACCGACTCCGACGTCAGGCTGTCTCGAAGAGTT
CTCCGGGACGTGCGCCGAGGGAGGGACCTGGAGCAGATTCTGACGCAGTACACCACCTTCGTGAAGCCG
GCCTTCGAGGAGTTCTGCCTGCCGACAAAGAAGTATGCCGATGTGATCATCCCGCGAGGAGTGGACAAT
ATGGTTGCCATCAACCTGATCGTGCAGCACATCCAGGACATTCTGAATGGTGACATCTGCAAATGGCAC
CGAGGAGGGTCCAATGGGCGGAGCTACAAGCGGACCTTTTCTGAGCCAGGGGACCACCCTGGGATGCTG
ACCTCTGGCAAACGGTCACATTTGGAGTCCAGCAGCAGACCCCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261450
Insert Size 807 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261450.1
RefSeq Size 2164 bp
RefSeq ORF 807 bp
Locus ID 83549
UniProt ID Q9HA47
Protein Families Druggable Genome
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
MW 30.7 kDa
Gene Summary This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' coding region, compared to variant 1, that results in a protein (isoform c) with a shorter N-terminus, compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...