Neuronal membrane glycoprotein M6 a (GPM6A) (NM_001261448) Human Untagged Clone

CAT#: SC330715

GPM6A (untagged) - Homo sapiens glycoprotein M6A (GPM6A), transcript variant 5



  "NM_001261448" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GPM6A Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPM6; M6A
Vector pCMV6-Entry
Sequence Data
>SC330715 representing NM_001261448.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACAGACCTGGAAGGGTGTTTTGAATGCTGTATCAAATGCCTGGGGGGCATTCCCTATGCCTCTCTG
ATTGCCACCATCCTGCTCTATGCGGGTGTTGCCCTGTTCTGTGGCTGCGGTCATGAAGCGCTTTCTGGA
ACTGTCAACATTCTGCAAACCTACTTTGAGATGGCAAGAACTGCTGGAGACACACTGGATGTTTTTACC
ATGATTGACATCTTTAAGTATGTGATCTACGGCATCGCAGCTGCGTTCTTTGTGTATGGCATTTTGCTG
ATGGTGGAAGGTTTCTTCACAACTGGGGCCATCAAAGATCTCTATGGGGATTTCAAAATCACCACTTGT
GGCAGATGTGTGAGCGCTTGGTTCATTATGCTGACATATCTTTTCATGTTGGCCTGGCTGGGAGTCACG
GCTTTCACCTCACTGCCAGTTTACATGTACTTCAATCTGTGGACCATCTGCCGGAACACCACATTAGTG
GAGGGAGCAAATCTCTGCTTGGACCTTCGTCAGTTTGGAATTGTGACAATTGGAGAGGAAAAGAAAATT
TGTACTGTCTCTGAGAATTTCTTGAGGATGTGCGAATCTACTGAGCTGAACATGACCTTCCACTTGTTT
ATTGTGGCACTTGCTGGAGCTGGGGCAGCAGTCATTGCTATGGTTCACTACCTTATGGTTCTGTCTGCC
AACTGGGCCTATGTGAAAGACGCCTGCCGGATGCAGAAGTATGAAGACATCAAGTCGAAGGAAGAGCAA
GAGCTTCATGACATCCACTCTACTCGCTCCAAAGAGCGGCTCAATGCATACACATAA

Restriction Sites SgfI-MluI     
ACCN NM_001261448
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261448.1
RefSeq Size 3114 bp
RefSeq ORF 816 bp
Locus ID 2823
UniProt ID P51674
Protein Families Transmembrane
MW 30.4 kDa
Gene Summary Involved in neuronal differentiation, including differentiation and migration of neuronal stem cells. Plays a role in neuronal plasticity and is involved in neurite and filopodia outgrowth, filopodia motility and probably synapse formation. GPM6A-induced filopodia formation involves mitogen-activated protein kinase (MAPK) and Src signaling pathways. May be involved in neuronal NGF-dependent Ca(2+) influx. May be involved in regulation of endocytosis and intracellular trafficking of G-protein-coupled receptors (GPCRs); enhances internalization and recycling of mu-type opioid receptor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Neuronal membrane glycoprotein M6 a产品

Customer Reviews 
Loading...