Dynamitin (DCTN2) (NM_001261413) Human Untagged Clone

CAT#: SC330705

DCTN2 (untagged) - Homo sapiens dynactin 2 (p50) (DCTN2), transcript variant 3



  "NM_001261413" in other vectors (2)

CNY 3,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DCTN2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DCTN50; DYNAMITIN; HEL-S-77; RBP50
Vector pCMV6-Entry
Sequence Data
>SC330705 representing NM_001261413.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGACCCTAAATACGCCGACCTTCCCGGCATTGCCAGGAATGAGCCAGATGTTTATGAAACTAGC
GACCTACCTGAGGATGATCAAGCGGAGTTCGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATC
ATTGTCAATCCTAATGCTGCCTATGACAAGTTCAAGGACAAGAGAGTGGGGACAAAGGGACTTGATTTC
TCAGATCGTATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGT
CTGGGAGTGAAGGAGACACCCCAGCAAAAGTACCAGCGCCTACTGCATGAGGTCCAAGAGCTGACAACT
GAAGTTGAAAAAATCAAGACGACAGTGAAGGAGTCAGCCACAGAGGAGAAGCTGACCCCTGTGTTGCTG
GCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGGTTGCTTCCCACCTGGAGAAGCTGCTGGGACCAGAT
GCTGCAATCAACCTTACCGACCCCGATGGCGCCCTGGCTAAGCGCCTACTACTGCAGCTGGAAGCAACA
AAGAACAGCAAAGGGGGATCAGGGGGAAAAACCACTGGGACCCCCCCAGATAGCAGCCTTGTCACTTAT
GAACTACATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTCGCAGAACTTGAAAAGCGC
CTGACAGAGCTGGAGACAGCTGTACGTTGTGATCAGGATGCTCAGAATCCCCTTTCTGCAGGTCTACAG
GGAGCCTGTCTCATGGAGACTGTAGAGCTGTTGCAAGCAAAGGTGAGCGCCCTAGACCTTGCAGTTTTG
GATCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGGTGAACGAGATTGCCAAGCATAAAGCCTCT
GTAGAAGATGCAGATACACAAAGCAAGGTGCACCAGCTATATGAAACTATACAGCGCTGGAGCCCCATT
GCCTCCACCCTCCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTGCACGAGCAAGCCATGCAG
TTTGGTCAGCTCCTGACACACTTGGATACCACCCAGCAGATGATTGCTAATTCCTTGAAGGACAATACC
ACCCTCTTGACCCAGGTGCAGACAACCATGCGTGAAAACCTGGCCACAGTTGAGGGGAACTTTGCCAGC
ATTGATGAACGGATGAAGAAGCTGGGAAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261413
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261413.1
RefSeq Size 2113 bp
RefSeq ORF 1206 bp
Locus ID 10540
UniProt ID Q13561
Protein Pathways Huntington's disease
MW 44.2 kDa
Gene Summary This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) lacks two exons in the 5' coding region but maintains the reading frame, compared to variant 1. The resulting isoform (3) lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...