Granzyme M (GZMM) (NM_001258351) Human Untagged Clone

CAT#: SC330672

GZMM (untagged) - Homo sapiens granzyme M (lymphocyte met-ase 1) (GZMM), transcript variant 2



  "NM_001258351" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GZMM rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LMET1; MET1
Vector pCMV6-Entry
Sequence Data
>SC330672 representing NM_001258351.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTCACTGCAGAGAAATGGCTCCCACCTGTGCGGGGGTGTCCTGGTGCACCCAAAGTGGGTGCTG
ACGGCTGCCCACTGCCTGGCCCAGCGGATGGCCCAGCTGAGGCTGGTGCTGGGGCTCCACACCCTGGAC
AGCCCCGGTCTCACCTTCCACATCAAGGCAGCCATCCAGCACCCTCGCTACAAGCCCGTCCCTGCCCTG
GAGAACGACCTCGCGCTGCTTCAGCTGGACGGGAAAGTGAAGCCCAGCCGGACCATCCGGCCGTTGGCC
CTGCCCAGTAAGCGCCAGGTGGTGGCAGCAGGGACTCGGTGCAGCATGGCCGGCTGGGGGCTGACCCAC
CAGGGCGGGCGCCTGTCCCGGGTGCTGCGGGAGCTGGACCTCCAAGTGCTGGACACCCGCATGTGTAAC
AACAGCCGCTTCTGGAACGGCAGCCTCTCCCCCAGCATGGTCTGCCTGGCGGCCGACTCCAAGGACCAG
GCTCCCTGCAAGGGTGACTCGGGCGGGCCCCTGGTGTGTGGCAAAGGCCGGGTGTTGGCCGGAGTCCTG
TCCTTCAGCTCCAGGGTCTGCACTGACATCTTCAAGCCTCCCGTGGCCACCGCTGTGGCGCCTTACGTG
TCCTGGATCAGGAAGGTCACCGGCCGATCGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258351
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258351.1
RefSeq Size 954 bp
RefSeq ORF 657 bp
Locus ID 3004
UniProt ID P51124
Protein Families Druggable Genome, Protease, Secreted Protein, Transmembrane
MW 23.4 kDa
Gene Summary Human natural killer (NK) cells and activated lymphocytes express and store a distinct subset of neutral serine proteases together with proteoglycans and other immune effector molecules in large cytoplasmic granules. These serine proteases are collectively termed granzymes and include 4 distinct gene products: granzyme A, granzyme B, granzyme H, and the protein encoded by this gene, granzyme M. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...