COPS4 (NM_001258006) Human Untagged Clone

CAT#: SC330628

COPS4 (untagged) - Homo sapiens COP9 signalosome subunit 4 (COPS4), transcript variant 2



  "NM_001258006" in other vectors (2)

CNY 3,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-COPS4 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSN4; SGN4
Vector pCMV6-Entry
Sequence Data
>SC330628 representing NM_001258006.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCAGCCGTGCGACAGGATTTGGCCCAGCTCATGAATTCGAGCGGCTCTCATAAAGATCTGGCT
GGCAAGTATCGTCAGATCCTGGAAAAAGCCATTCAGTTATCTGGAGCAGAACAACTAGAAGCTTTGAAA
GCTTTTGTGGAAGCAATGGTAAATGAGAATGTCAGTCTCGTGATCTCGCGGCAGTTGCTGACTGATTTT
TGCACACATCTTCCTAACTTGCCTGATAGCACAGCCAAAGAAATCTATCACTTCACCTTGGAAAAGATC
CAGCCTAGAGTCATTTCATTTGAGGAGCAGGTTGCTTCCATAAGACAGCATCTTGCATCTATATATGAG
AAAGAAGAAGATTGGAGAAATGCAGCCCAAGTGTTGGTGGGAATTCCTTTGGAAACAGGACAAAAACAG
TACAATGTAGATTATAAACTGGAGACTTACTTGAAGATTGCTAGGCTATATCTGGAGGATGATGATCCA
GTCCAGGCAGAGGCTTACATAAATCGAGCATCGTTGCTTCAGAATGAATCAACCAATGAACAATTACAG
ATACATTATAAGGTATGCTATGCACGTGTTCTTGATTATAGAAGAAAATTCATTGAAGCTGCACAAAGG
TACAATGAGCTCTCTTACAAGACAATAGTCCACGAAAGTGAAAGACTAGAGGCCTTAAAACATGCTTTG
CACTGTACGATCTTAGCATCAGCAGGGCAGCAGCGTTCTCGGATGCTAGCTACTCTTTTTAAGGATGAA
AGGTGCCAGCAACTTGCTGCCTATGGGATCCTAGAGAAAATGTATCTAGATAGGATCATCAGAGGAAAT
CAACTTCAAGAATTTGCTGCCATGCTGATGCCTCACCAAAAAGCAACTACAGCTGATGGTTCCAGCATC
TTGGACAGAGCTGTTATTGAACACAATTTGTTGTCTGCAAGCAAATTATATAATAATATTACCTTCGAA
GAACTTGGAGCTCTTTTAGAGATCCCTGCAGCTAAGCACGAGAAGCCCTGCCAACGTGGGATAAGCAGA
TCCAATCACTTTGTTTCCAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258006
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258006.1
RefSeq Size 1680 bp
RefSeq ORF 1059 bp
Locus ID 51138
UniProt ID Q9BT78
MW 40.2 kDa
Gene Summary This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...