Cathepsin L (CTSL) (NM_001257973) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CATL; CTSL1; MEP
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330624 representing NM_001257973. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATTATGCTTTCCAGTATGTTCAGGATAATGGAGGCCTGGACTCTGAGGAATCCTATCCATATGAG GCAACAGAAGAATCCTGTAAGTACAATCCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATC CCTAAGCAGGAGAAGGCCCTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCA GGTCATGAGTCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATG GATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAATATTGGCTG GTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATGGCCAAAGACCGGAGAAAC CATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001257973
Insert Size	456 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001257973.1
RefSeq Size	1141 bp
RefSeq ORF	456 bp
Locus ID	1514
Protein Families	Druggable Genome, Protease
Protein Pathways	Antigen processing and presentation, Lysosome
MW	16.8 kDa
Gene Summary	The protein encoded by this gene is a lysosomal cysteine proteinase that plays a major role in intracellular protein catabolism. Its substrates include collagen and elastin, as well as alpha-1 protease inhibitor, a major controlling element of neutrophil elastase activity. The encoded protein has been implicated in several pathologic processes, including myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria. This protein, which is a member of the peptidase C1 family, is a dimer composed of disulfide-linked heavy and light chains, both produced from a single protein precursor. Additionally, this protein cleaves the S1 subunit of the SARS-CoV-2 spike protein, which is necessary for entry of the virus into the cell. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream AUG, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.