FE65 (APBB1) (NM_001257319) Human Untagged Clone

CAT#: SC330596

APBB1 (untagged) - Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 9



  "NM_001257319" in other vectors (2)

CNY 4,660.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
APBB1 mouse monoclonal antibody,clone OTI3H9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FE65; MGC:9072; RIR
Vector pCMV6-Entry
Sequence Data
>SC330596 representing NM_001257319.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGCCATGTTCTCCCAGGACTTTTTCCTGGCCATTATCCTGCAGGACAGCAGCGCAGATTCCTTC
TGGAACCCCAACGCCTTCGAGACGGATTCCGACCTGCCGGCTGGATGGATGAGGGTCCAGGACACCTCA
GGGACCTATTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCCCCCGGCCGGGCCTCCCCCTCA
CAGGGGAGCAGCCCCCAAGAGGAGTCCCAGCTCACCTGGACAGGTTTTGCTCATGGAGAAGGCTTTGAG
GATGGAGAATTTTGGAAGGATGAACCCAGTGATGAGGCCCCAATGGAGCTGGGACTGAAGGAACCTGAG
GAGGGGACGTTGACCTTCCCAGCTCAGAGCCTCAGCCCAGAGCCGTTGCCCCAAGAGGAGGAGAAGCTT
CCCCCACGGAATACCAACCCAGGGATCAAGTGTTTCGCCGTGCGCTCCCTAGGCTGGGTAGAGATGACC
GAGGAGGAGCTGGCCCCTGGACGCAGCAGTGTGGCAGTCAACAATTGCATCCGTCAGCTCTCTTACCAC
AAAAACAACCTGCATGACCCCATGTCTGGGGGCTGGGGGGAAGGAAAGGATCTGCTACTGCAGCTGGAG
GATGAGACACTAAAGCTAGTGGAGCCACAGAGCCAGGCACTGCTGCACGCCCAACCCATCATCAGCATC
CGCGTGTGGGGCGTCGGGCGGGACAGTGGAAGAGAGAGGGACTTTGCCTACGTAGCTCGTGATAAGCTG
ACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAGAACATCGCCACCAGCCTGCAT
GAGATCTGCTCTAAGATCATGGCCGAACGGCGTAATGCCCGCTGCTTGGTAAATGGACTCTCCCTGGAC
CACTCTAAACTTGTGGATGTCCCTTTCCAAGTGGAATTCCCAGCGCCTAAGAATGAGTTGGTCCAGAAG
TTCCAAGTCTATTACCTGGGGAATGTACCTGTTGCTAAACCTGTTGGGGTAGATGTGATTAATGGGGCC
CTCGAGTCAGTCCTGTCCTCCAGCAGCCGTGAACAATGGACCCCAAGTCATGTCAGTGTGGCCCCTGCT
ACCCTCACCATCTTGCACCAGCAGACAGAGGCAGTGCTGGGAGAGTGTCGGGTGCGTTTCCTCTCCTTC
CTGGCCGTGGGCAGAGATGTCCACACGTTTGCATTCATCATGGCTGCCGGCCCAGCCTCCTTCTGCTGC
CACATGTTCTGGTGCGAGCCCAATGCTGCCAGCCTCTCAGAGGCTGTGCAGGCTGCGTGCATGCTTCGC
TACCAGAAGTGTCTGGATGCCCGTTCCCAGGCCTCCACCTCCTGCCTCCCAGCACCCCCTGCTGAGTCT
GTGGCACGGCGTGTAGGGTGGACTGTCCGCAGGGGTGTTCAGTCGCTGTGGGGCTCCCTGAAGCCCAAA
CGGCTGGGGGCCCATACCCCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001257319
Insert Size 1473 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257319.2
RefSeq Size 2026 bp
RefSeq ORF 1473 bp
Locus ID 322
UniProt ID O00213
Protein Families Transcription Factors
Protein Pathways Alzheimer's disease
MW 54.2 kDa
Gene Summary The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (9) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (g) with a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...