Glycerol 3 Phosphate Dehydrogenase (GPD1) (NM_001257199) Human Untagged Clone

CAT#: SC330577

GPD1 (untagged) - Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble) (GPD1), transcript variant 2



  "NM_001257199" in other vectors (2)

CNY 3,140.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-GPD1 Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPD-C; GPDH-C; HTGTI
Vector pCMV6-Entry
Sequence Data
>SC330577 representing NM_001257199.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGT
GGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGA
GGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTG
CCCCCAAATGTGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGC
ATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAG
CGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTC
TGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCA
AACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTG
GCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTG
GGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTG
GAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCC
TTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGG
CCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTC
ATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCAT
CCAGAACATATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257199
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257199.1
RefSeq Size 3014 bp
RefSeq ORF 981 bp
Locus ID 2819
UniProt ID P21695
Protein Pathways Glycerophospholipid metabolism
MW 35.1 kDa
Gene Summary This gene encodes a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. The encoded protein plays a critical role in carbohydrate and lipid metabolism by catalyzing the reversible conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. The encoded cytosolic protein and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in this gene are a cause of transient infantile hypertriglyceridemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Glycerol 3 Phosphate Dehydrogenase产品

Customer Reviews 
Loading...