PDLIM5 (NM_001256429) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ENH; ENH1; L9; LIM
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330427 representing NM_001256429. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCAACTACAGTGTGTCACTGGTTGGCCCAGCTCCTTGGGGTTTCCGGCTGCAGGGCGGTAAGGAT TTCAACATGCCTCTGACAATCTCTAGTGCTGGAGTGCAGTGGCGCAATCTCGGCTCACCACAACCTCCA TCTCCCGAGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGTGCCACCA CGCCTGGCTAATTTTGTATTTTTAGTAGAGACCAAGTTTCCCTATGTTGGTCAGGCTGGTCTTGAACTC CCGACCTCAGGTGATCTGCCCACCTCGGCCTCCCAAAGTGCTAAGATTACAGGCGTGAGCCACCGTGCC TGGCCCACACTGTTTTATACTTTGCTTTTTTTTGCAACAATTTACCCTGAGATCATTCTCTATTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001256429
Insert Size	411 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001256429.1
RefSeq Size	1223 bp
RefSeq ORF	411 bp
Locus ID	10611
UniProt ID	Q96HC4
Protein Families	Druggable Genome
MW	15.1 kDa
Gene Summary	This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (9) lacks several central and 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (i) has the same N-terminus but has a distinct and significantly shorter C-terminus, compared to isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.