ELOVL1 (NM_001256402) Human Untagged Clone

CAT#: SC330415

ELOVL1 (untagged) - Homo sapiens ELOVL fatty acid elongase 1 (ELOVL1), transcript variant 4



  "NM_001256402" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ELOVL1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-88; IKSHD; Ssc1
Vector pCMV6-Entry
Sequence Data
>SC330415 representing NM_001256402.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGGCTGGCTGAGCACCTATACCTGGCGCTGTGACCCTGTGGACTATTCCAACAGCCCTGAGGCA
CTTAGGATGGTTCGGGTGGCCTGGCTCTTCCTCTTCTCCAAGTTCATTGAGCTGATGGACACAGTGATC
TTTATTCTCCGAAAGAAAGACGGGCAGGTGACCTTCCTACATGTCTTCCATCACTCTGTGCTTCCCTGG
AGCTGGTGGTGGGGGGTAAAGATTGCCCCGGGAGGAATGGGCTCTTTCCATGCCATGATAAACTCTTCC
GTGCATGTCATAATGTACCTGTACTACGGATTATCTGCCTTTGGCCCTGTGGCACAACCCTACCTTTGG
TGGAAAAAGCACATGACAGCCATTCAGCTGATCCAGTTTGTCCTGGTCTCACTGCACATCTCCCAGTAC
TACTTTATGTCCAGCTGTAACTACCAGTACCCAGTCATTATTCACCTCATCTGGATGTATGGCACCATC
TTCTTCATGCTGTTCTCCAACTTCTGGTATCACTCTTATACCAAGGGCAAGCGGCTGCCCCGTGCACTT
CAGCAAAATGGAGCTCCAGGTATTGCCAAGGTCAAGGCCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256402
Insert Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256402.1
RefSeq Size 1347 bp
RefSeq ORF 597 bp
Locus ID 64834
UniProt ID Q9BW60
Protein Families Transmembrane
MW 23.3 kDa
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis. Indirectly inhibits RPE65 via production of VLCFAs.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an alternate exon which results in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...