Brk (PTK6) (NM_001256358) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	BRK
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330401 representing NM_001256358. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTGTCCCGGGACCAGGCTCACCTGGGCCCCAAGTATGTGGGCCTCTGGGACTTCAAGTCCCGGACG GACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCCAGGAAGGAGGAGCAGTGGTGGTGG GCCACGCTGCTGGACGAGGCGGGTGGGGCCGTGGCCCAGGGCTATGTGCCCCACAACTACCTGGCCGAG AGGGAGACGGTGGAGTCGGAACCTGCGGGACACGCAGGCTGTGCGGCACTACAAGATCTGGCGGCGTGC CGGGGGCCGGCTGCACCTGAACGAGGCGGTGTCCTTCCTCAGCCTGCCCGAGCTTGTGAACTACCACAG GGCCCAGAGCCTGTCCCACGGCCTGCGGCTGGCCGCGCCCTGCCGGAAGCACGAGCCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001256358
Insert Size	405 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001256358.1
RefSeq Size	2413 bp
RefSeq ORF	405 bp
Locus ID	5753
UniProt ID	Q13882
Protein Families	Druggable Genome, Protein Kinase, Secreted Protein
MW	14.5 kDa
Gene Summary	The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) lacks an exon in the 5' coding region which results in a frameshift and early stop codon, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. This variant is also known as lambdaM5 and Alt-PTK6. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.