RAB34 (NM_001256277) Human Untagged Clone

CAT#: SC330388

RAB34 (untagged) - Homo sapiens RAB34, member RAS oncogene family (RAB34), transcript variant 6



  "NM_001256277" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RAB34 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NARR; RAB39; RAH
Vector pCMV6-Entry
Sequence Data
>SC330388 representing NM_001256277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAG
GCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGC
ACCGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATT
AATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAA
CGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAA
TGCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCA
TCTCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTC
TTCCTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTC
CAGGTGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAA
TTCTTCTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCT
CGACGCATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAG
AAGCCCACATGTTGCCCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256277
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256277.1
RefSeq Size 1467 bp
RefSeq ORF 780 bp
Locus ID 83871
UniProt ID Q9BZG1
Protein Families Druggable Genome
MW 29 kDa
Gene Summary This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Both variants 1 and 6 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...