ALIX (PDCD6IP) (NM_001256192) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	AIP1; ALIX; DRIP4; HP95
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330382 representing NM_001256192. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGACATTCATCTCGGTGCAGCTGAAAAAGACCTCAGAGGTGGACCTGGCCAAGCCGCTGGTGAAG TTCATCCAGCAGACTTACCCAAGCGGCGGGGAAGAGCAGGCCCAGTACTGCCGCGCGGCGGAGGAGCTC AGCAAGCTGCGCCGCGCCGCAGTCGGTCGTCCGCTGGACAAGCACGAGGGCGCGCTCGAGACGCTCCTG AGATATTATGATCAGATTTGTTCTATTGAACCCAAATTCCCATTTTCTGAAAATCAGATCTGCTTGACA TTTACCTGGAAGGATGCTTTCGATAAAGGTTCACTTTTTGGAGGCTCTGTAAAACTGGCTCTTGCAAGC TTAGGATATGAAAAGAGCTGTGTGTTGTTCAATTGTGCAGCCTTAGCTAGCCAAATTGCAGCAGAACAG AACCTGGATAATGATGAAGGATTGAAAATCGCTGCTAAACATTACCAGTTTGCTAGTGGTGCCTTTTTA CATATTAAAGAGACGGTTTTATCTGCCTTAAGTCGAGAGCCGACCGTGGACATATCTCCAGATACTGTT GGGACCCTCAGTCTTATTATGCTGGCACAGGCTCAAGAAGTATTTTTTTTAAAAGCCACAAGAGATAAA ATGAAAGATGCCATCATAGCTAAATTGGCTAATCAGGCTGCAGATTATTTTGGTGATGCTTTCAAACAG TGTCAATACAAAGATACTCTCCCCAAGGTCAGTTATTGTTTTTATAAACACTTGCTTACTTTGCATGTG AAATATTTAGACTTTTTTGTGTATAAGAAGCAAGTTGAAACTTATAAAGAAATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001256192
Insert Size	816 bp
OTI Disclaimer	Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001256192.1
RefSeq Size	1569 bp
RefSeq ORF	816 bp
Locus ID	10015
UniProt ID	Q8WUM4
Protein Families	Druggable Genome
Protein Pathways	Endocytosis
MW	30.5 kDa
Gene Summary	This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 2. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 2.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.