Actin Regulatory Protein CAPG (CAPG) (NM_001256139) Human Untagged Clone

CAT#: SC330373

CAPG (untagged) - Homo sapiens capping protein (actin filament), gelsolin-like (CAPG), transcript variant 2



  "NM_001256139" in other vectors (2)

CNY 3,330.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-CAPG rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AFCP; HEL-S-66; MCP
Vector pCMV6-Entry
Sequence Data
>SC330373 representing NM_001256139.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACACAGCCATTCCCCAGAGTGGCTCTCCATTCCCAGGCTCAGTGCAGGATCCAGGCCTGCATGTG
TGGCGGGTGGAGAAGCTGAAGCCGGTGCCTGTGGCGCAAGAGAACCAGGGCGTCTTCTTCTCGGGGGAC
TCCTACCTAGTGCTGCACAATGGCCCAGAAGAGGTTTCCCATCTGCACCTGTGGATAGGCCAGCAGTCA
TCCCGGGATGAGCAGGGGGCCTGTGCCGTGCTGGCTGTGCACCTCAACACGCTGCTGGGAGAGCGGCCT
GTGCAGCACCGCGAGGTGCAGGGCAATGAGTCTGACCTCTTCATGAGCTACTTCCCACGGGGCCTCAAG
TACCAGGAAGGTGGTGTGGAGTCAGCATTTCACAAGACCTCCACAGGAGCCCCAGCTGCCATCAAGAAA
CTCTACCAGGTGAAGGGGAAGAAGAACATCCGTGCCACCGAGCGGGCACTGAACTGGGACAGCTTCAAC
ACTGGGGACTGCTTCATCCTGGACCTGGGCCAGAACATCTTCGCCTGGTGTGGTGGAAAGTCCAACATC
CTGGAACGCAACAAGGCGAGGGACCTGGCCCTGGCCATCCGGGACAGTGAGCGACAGGGCAAGGCCCAG
GTGGAGATTGTCACTGATGGGGAGGAGCCTGCTGAGATGATCCAGGTCCTGGGCCCCAAGCCTGCTCTG
AAGGAGGGCAACCCTGAGGAAGACCTCACAGCTGACAAGGCAAATGCCCAGGCCGCAGCTCTGTATAAG
GTCTCTGATGCCACTGGACAGATGAACCTGACCAAGGTGGCTGACTCCAGCCCATTTGCCCTTGAACTG
CTGATATCTGATGACTGCTTTGTGCTGGACAACGGGCTCTGTGGCAAGATCTATATCTGGAAGGGGCGA
AAAGCGAATGAGAAGGAGCGGCAGGCAGCCCTGCAGGTGGCCGAGGGCTTCATCTCGCGCATGCAGTAC
GCCCCGAACACTCAGGTGGAGATTCTGCCTCAGGGCCATGAGAGTCCCATCTTCAAGCAATTTTTCAAG
GACTGGAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256139
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256139.1
RefSeq Size 1314 bp
RefSeq ORF 1047 bp
Locus ID 822
UniProt ID P40121
MW 38.5 kDa
Gene Summary This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 4, and 5 all encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...