ARD1A (NAA10) (NM_001256119) Human Untagged Clone
CAT#: SC330366
NAA10 (untagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330366 representing NM_001256119.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAACATCCGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCC GAGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTACATTGCTGAG GACGAGAATGGGAAGATTGTGGGGTATGTCCTGGCCAAAATGGAAGAGGACCCAGATGATGTGCCCCAT GGACATATCACCTCATTGGCTGTGAAGCGTTCCCACCGGCGCCTCGGTCTGGCTCAGAAACTGATGGAC CAGGCCTCTCGAGCCATGATAGAGAACTTCAATGCCAAATATGTCTCCCTGCATGTCAGGAAGAGGATC AGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGACGCCTATGCCATGAAGCGGGACCTCACTCAG ATGGCCGACGAGCTGAGGCGGCACCTGGAGCTGAAAGAGAAGGGCAGGCACGTGGTGCTGGGTGCCATC GAGAACAAGGTGGAGAGCAAAGGCAATTCACCTCCGAGCTCAGGAGAGGCCTGTCGCGAGGAGAAGGGC CTGGCTGCCGAGGATAGTGGTGGGGACAGCAAGGACCTCAGCGAGGTCAGCGAGACCACAGAGAGCACA GATGTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256119 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256119.1 |
RefSeq Size | 1091 bp |
RefSeq ORF | 663 bp |
Locus ID | 8260 |
UniProt ID | P41227 |
Protein Families | Druggable Genome |
Protein Pathways | Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism |
MW | 24.8 kDa |
Gene Summary | N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232182 | NAA10 (Myc-DDK tagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 2 |
CNY 3,990.00 |
|
RG232182 | NAA10 (tGFP-tagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 2 |
CNY 4,370.00 |