ATF2 (NM_001256092) Human Untagged Clone

CAT#: SC330362

ATF2 (untagged) - Homo sapiens activating transcription factor 2 (ATF2), transcript variant 4



  "NM_001256092" in other vectors (2)

CNY 4,280.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ATF2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRE-BP1; CREB-2; CREB2; HB16; TREB7
Vector pCMV6-Entry
Sequence Data
>SC330362 representing NM_001256092.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACTGCGCCTGGATGTGGCCAGATCAGACCCCAACACCAACAAGATTCTTGAAAAACTGTGAAGAA
GTGGGTTTGTTTAATGAGTTGGCGAGTCCATTTGAGAATGAATTCAAGAAAGCTTCAGAAGATGACATT
AAAAAAATGCCTCTAGATTTATCCCCTCTTGCAACACCTATCATAAGAAGCAAAATTGAGGAGCCTTCT
GTTGTAGAAACAACTCACCAGGATAGTCCTTTACCTCACCCAGAGTCTACTACCAGTGATGAGAAGGAA
GTACCATTGGCACAAACTGCACAGCCCACATCAGCTATTGTTCGTCCAGCATCATTACAGGTTCCCAAT
GTGCTGCTTACAAGTTCTGACTCAAGTGTAATTATTCAGCAGGCAGTACCTTCACCAACCTCAAGTACT
GTAATCACCCAGGCACCATCCTCTAACAGGCCAATTGTCCCTGTACCAGGCCCATTTCCTCTTCTGTTA
CATCTTCCTAATGGACAAACCATGCCTGTTGCTATTCCTGCATCAATTACAAGTTCTAATGTGCATGTT
CCAGCTGCAGTCCCACTCGTTCGACCAGTCACCATGGTGCCTAGTGTTCCAGGAATCCCAGGTCCTTCC
TCTCCCCAACCAGTACAGTCAGAAGCAAAAATGAGATTAAAAGCTGCTTTGACCCAGCAACATCCTCCA
GTTACCAATGGTGATACTGTCAAAGGTCATGGTAGCGGATTGGTTAGGACTCAGTCAGAGGAATCTCGA
CCGCAGTCATTACAACAGCCAGCCACATCCACTACAGAAACTCCGGCTTCTCCAGCTCACACAACTCCA
CAGACCCAAAGTACAAGTGGTCGTCGGAGAAGAGCAGCTAACGAAGATCCTGATGAAAAAAGGAGAAAG
TTTTTAGAGCGAAATAGAGCAGCAGCTTCAAGATGCCGACAAAAAAGGAAAGTCTGGGTTCAGTCTTTA
GAGAAGAAAGCTGAAGACTTGAGTTCATTAAATGGTCAGCTGCAGAGTGAAGTCACCCTGCTGAGAAAT
GAAGTGGCACAGCTGAAACAGCTTCTTCTGGCTCATAAAGATTGCCCTGTAACCGCCATGCAGAAGAAA
TCTGGCTATCATACTGCTGATAAAGATGATAGTTCAGAAGACATTTCAGTGCCGAGTAGTCCACATACA
GAAGCTATACAGCATAGTTCGGTCAGCACATCCAATGGAGTCAGTTCAACCTCCAAGGCAGAAGCTGTA
GCCACTTCAGTCCTCACCCAGATGGCGGACCAGAGTACAGAGCCTGCTCTTTCACAGATCGTTATGGCT
CCTTCCTCCCAGTCACAGCCCTCAGGAAGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256092
Insert Size 1344 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256092.1
RefSeq Size 4096 bp
RefSeq ORF 1344 bp
Locus ID 1386
UniProt ID P15336
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
MW 48 kDa
Gene Summary This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (4) lacks an internal exon compared to variant 1. This results in translation initiation from another start site, and a shorter isoform (3) with a distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...